SCF3261, SCF3261 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF3261
Genbank IDKP278604
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)10
Primer 1SCF3261.forward primer: GTTTACCATATTCACTCCTTCC
Primer 2SCF3261.reverse primer: TGAGACAGACCTAACATTTGAC
Max Length268
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2007LG12N/A5.4SCF3261ViewN/A
2Cranberry-CNJ02-1-2007LG12N/A2.8SCF3261ViewN/A
3Cranberry-CNJ02-1-2017LG12N/A4SCF3261ViewN/A
4Cranberry-Mullica_Queen-2017LG12N/A0SCF3261ViewN/A
5Cranberry-Crimson_Queen-2017LG12N/A0SCF3261ViewN/A
6Cranberry-Mullica_Queen-2007LG12N/A0SCF3261ViewN/A
7Cranberry-Composite_map-F1LG12N/A86.61SCF3261ViewN/A
8Cranberry-Crimson_Queen-F1LG12N/A60.91SCF3261ViewN/A
9Cranberry-GH1/35-F1LG12N/A88.81SCF3261ViewN/A
10Cranberry-Mullica_Queen_1-F1LG12N/A104.7SCF3261ViewN/A
11Cranberry-Stevens-F1LG12N/A67.69SCF3261ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278604
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF3261.forward primerVaccinium macrocarponprimer
reverse primerSCF3261.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF3261SCF3261Vaccinium macrocarponmarker_locus
SCF3261SCF3261-86.61Vaccinium macrocarponmarker_locus
SCF3261SCF3261-60.91Vaccinium macrocarponmarker_locus
SCF3261SCF3261-88.81Vaccinium macrocarponmarker_locus
SCF3261SCF3261-104.7Vaccinium macrocarponmarker_locus
SCF3261SCF3261-67.69Vaccinium macrocarponmarker_locus