SCF30816, SCF30816 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF30816
Genbank IDKP278685
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TCG)8
Primer 1SCF30816.forward primer: GTCCAAAATAGCATCGAAAG
Primer 2SCF30816.reverse primer: CGCATTACTTCTTCACTATACG
Max Length216
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG01N/A2.6SCF30816ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A0SCF30816ViewN/A
3Blueberry-F1#10_x_W85-23-F1-2017LG01N/A0SCF30816ViewN/A
4Cranberry-CNJ02-1-2007LG1N/A3.25SCF30816ViewN/A
5Cranberry-Crimson_Queen-2007LG1N/A0.3SCF30816ViewN/A
6Blueberry-F1#10-2017LG01N/A0SCF30816ViewN/A
7Cranberry-Composite_map-F1LG01N/A96.39SCF30816ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A79.29SCF30816ViewN/A
9Cranberry-GH1/35-F1LG01N/A89.25SCF30816ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278685
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF30816.forward primerVaccinium macrocarponprimer
reverse primerSCF30816.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF30816SCF30816Vaccinium macrocarponmarker_locus
SCF30816SCF30816-96.39Vaccinium macrocarponmarker_locus
SCF30816SCF30816-79.29Vaccinium macrocarponmarker_locus
SCF30816SCF30816-89.25Vaccinium macrocarponmarker_locus