SCF31394, SCF31394 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF31394
Genbank IDKP278688
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)11
Primer 1SCF31394.forward primer: GTAGCAAAAGAAGAGACACCAT
Primer 2SCF31394.reverse primer: CGTTTTCCAGTTCCAGAGTA
Max Length287
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen_2-F1LG02N/A0SCF31394View
2Cranberry-Composite_map-F1LG02N/A0SCF31394View
3Cranberry-Mullica_Queen-2017LG02N/A112.3SCF31394View
4Cranberry-Mullica_Queen-2007LG2N/A117.6SCF31394View
5Cranberry-CNJ02-1-2007LG2N/A106.33SCF31394View
6Cranberry-Crimson_Queen-2007LG2N/A98SCF31394View
7Cranberry-CNJ02-1-2017LG02N/A102.3SCF31394View
8Cranberry-Crimson_Queen-F1LG02N/A0SCF31394View
9Cranberry-Crimson_Queen-2017LG02N/A92.7SCF31394View
10Cranberry-Mullica_Queen_1-F1LG02N/A0SCF31394View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278688
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF31394.forward primerVaccinium macrocarponprimer
reverse primerSCF31394.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF31394SCF31394Vaccinium macrocarponmarker_locus