scf31h, scf31h (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf31h
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf31h.forward primer: TGGAACTCCAAATGTGCGTA
Primer 2	scf31h.reverse primer: TGGCACCATAAATAGCACGA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr07	supercontig	Vmac_chr07:9679473..9679688 .
chr7	supercontig	chr7:9209860..9210079 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG7	N/A	29.06	scf31h	View
2	Cranberry-CNJ02-1-2007	LG7	N/A	69.52	scf31h	View
3	Cranberry-Crimson_Queen-2007	LG7	N/A	63.7	scf31h	View
4	Cranberry-Mullica_Queen-2007	LG7	N/A	77.9	scf31h	View
5	Cranberry-Unifiedmap2013	LG3	N/A	69.7	scf31h	View
6	Cranberry-CNJ02-1-2017	LG07	N/A	63.2	scf31h	View
7	Cranberry-Crimson_Queen-2017	LG07	N/A	60.4	scf31h	View
8	Cranberry-Mullica_Queen-2017	LG07	N/A	70.4	scf31h	View
9	Cranberry-[BG//BL/BN]95-F1	LG07	N/A	27.48	scf31h	View
10	Cranberry-Composite_map-F1	LG07	N/A	24.33	scf31h	View
11	Cranberry-Crimson_Queen-F1	LG07	N/A	26.83	scf31h	View
12	Cranberry-Mullica_Queen_1-F1	LG07	N/A	30.45	scf31h	View
13	Cranberry-BB/CQ-F1	LG03	N/A	26.78	scf31h	View