SCF33471, SCF33471 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF33471
Genbank ID	KP278692
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)12
Primer 1	SCF33471.forward primer: TTTATTGCACACGAGAACAG
Primer 2	SCF33471.reverse primer: ATATTTTGTCCACGCTCACT
Max Length	329
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278692

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr02	supercontig	Vmac_chr02:14370769..14371038 .
chr2	supercontig	chr2:14253483..14253746 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.