SCF32389, SCF32389 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF32389
Genbank ID	KP279002
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AG)10
Primer 1	SCF32389.forward primer: CACTATATCCTACCCCAAAGAG
Primer 2	SCF32389.reverse primer: TTTGCTGTGACTTGAAAGG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279002

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.