SCF3362, SCF3362 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF3362
Genbank IDKP278605
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TGC)9
Primer 1SCF3362.forward primer: GTACAGCAAAATTCAGCACA
Primer 2SCF3362.reverse primer: GGATTTATCTACAGCCCATTAC
Max Length372
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG1N/A21.04SCF3362ViewN/A
2Cranberry-CNJ02-1-2017LG01N/A20.2SCF3362ViewN/A
3Cranberry-Crimson_Queen-2007LG1N/A16.9SCF3362ViewN/A
4Cranberry-Crimson_Queen-2017LG01N/A16.7SCF3362ViewN/A
5Cranberry-Composite_map-F1LG01N/A94.93SCF3362ViewN/A
6Cranberry-Crimson_Queen-F1LG01N/A64.35SCF3362ViewN/A
7Cranberry-GH1/35-F1LG01N/A89.25SCF3362ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278605
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF3362.forward primerVaccinium macrocarponprimer
reverse primerSCF3362.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF3362SCF3362Vaccinium macrocarponmarker_locus
SCF3362SCF3362-94.93Vaccinium macrocarponmarker_locus
SCF3362SCF3362-64.35Vaccinium macrocarponmarker_locus
SCF3362SCF3362-89.25Vaccinium macrocarponmarker_locus