SCF3362, SCF3362 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDKP278605
SpeciesVaccinium macrocarpon
Repeat Motif(TGC)9
Primer 1SCF3362.forward primer: GTACAGCAAAATTCAGCACA
Primer 2SCF3362.reverse primer: GGATTTATCTACAGCCCATTAC
Max Length372
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
External references for this genetic_marker

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF3362.forward primerVaccinium macrocarponprimer
reverse primerSCF3362.reverse primerVaccinium macrocarponprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF3362SCF3362Vaccinium macrocarponmarker_locus
SCF3362SCF3362-94.93Vaccinium macrocarponmarker_locus
SCF3362SCF3362-64.35Vaccinium macrocarponmarker_locus
SCF3362SCF3362-89.25Vaccinium macrocarponmarker_locus