SCF34071, SCF34071 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF34071
Genbank ID	KP278694
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TG)10
Primer 1	SCF34071.forward primer: CGTGTGCAGATTTACTTCAG
Primer 2	SCF34071.reverse primer: AATTCATAGATCCCCATGAC
Max Length	276
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278694

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr12	supercontig	Vmac_chr12:9516242..9516487 .
chr12	supercontig	chr12:8621588..8621829 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG12	N/A	52.31	SCF34071	View
2	Cranberry-Mullica_Queen-2007	LG12	N/A	59.2	SCF34071	View
3	Blueberry-F1#10_x_W85-23-F1-2017	LG12	N/A	44.7	SCF34071	View
4	Blueberry-F1#10-2017	LG12	N/A	45.3	SCF34071	View
5	Blueberry-W85-23-2017	LG12	N/A	48.1	SCF34071	View
6	Cranberry-CNJ02-1-2017	LG12	N/A	48.9	SCF34071	View
7	Cranberry-Mullica_Queen-2017	LG12	N/A	56.8	SCF34071	View
8	Cranberry-Composite_map-F1	LG12	N/A	35.42	SCF34071	View
9	Cranberry-GH1/35-F1	LG12	N/A	36.26	SCF34071	View
10	Cranberry-Mullica_Queen_1-F1	LG12	N/A	39.97	SCF34071	View
11	Cranberry-Mullica_Queen_2-F1	LG12	N/A	16.88	SCF34071	View
12	Cranberry-Stevens-F1	LG12	N/A	19.53	SCF34071	View