SCF30010, SCF30010 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF30010
Genbank IDKP278683
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)9
Primer 1SCF30010.forward primer: CTCAAATCAACGATCAAGAC
Primer 2SCF30010.reverse primer: GAAAGAGACAACAAAACCCT
Max Length337
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG8N/A17.88SCF30010ViewN/A
2Cranberry-Crimson_Queen-2007LG8N/A21.7SCF30010ViewN/A
3Cranberry-Mullica_Queen-2007LG8N/A30.1SCF30010ViewN/A
4Cranberry-CNJ02-1-2017LG08N/A25.9SCF30010ViewN/A
5Blueberry-F1#10-2017LG08N/A32SCF30010ViewN/A
6Blueberry-F1#10_x_W85-23-F1-2017LG08N/A33.1SCF30010ViewN/A
7Cranberry-Crimson_Queen-2017LG08N/A22.1SCF30010ViewN/A
8Cranberry-CNJ02-1-2007LG8N/A25.94SCF30010ViewN/A
9Cranberry-Mullica_Queen-2017LG08N/A27.5SCF30010ViewN/A
10Cranberry-[BG//BL/BN]95-F1LG08N/A64.03SCF30010ViewN/A
11Cranberry-Composite_map-F1LG08N/A58.86SCF30010ViewN/A
12Cranberry-Crimson_Queen-F1LG08N/A50.11SCF30010ViewN/A
13Cranberry-Mullica_Queen_1-F1LG08N/A76.17SCF30010ViewN/A
14Cranberry-BB/CQ-F1LG04N/A30.65SCF30010ViewN/A
15Cranberry-BB/CQ-F1LG04N/A34.02SCF30010ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278683
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF30010.forward primerVaccinium macrocarponprimer
reverse primerSCF30010.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF30010SCF30010Vaccinium macrocarponmarker_locus
SCF30010SCF30010-64.03Vaccinium macrocarponmarker_locus
SCF30010SCF30010-58.86Vaccinium macrocarponmarker_locus
SCF30010SCF30010-50.11Vaccinium macrocarponmarker_locus
SCF30010SCF30010-76.17Vaccinium macrocarponmarker_locus
SCF30010SCF30010-30.649Vaccinium macrocarponmarker_locus
SCF30010SCF30010-34.015Vaccinium macrocarponmarker_locus