SCF46751, SCF46751 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF46751
Genbank IDKP278715
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)12
Primer 1SCF46751.forward primer: ACCAGATGAAGAAGAAGAAGC
Primer 2SCF46751.reverse primer: GCCTCTCATTACCATTACAAAC
Max Length325
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2017LG05N/A43.6SCF46751ViewN/A
2Blueberry-F1#10_x_W85-23-F1-2017LG05N/A52.7SCF46751ViewN/A
3Cranberry-BB/CQ-F1LG10N/A17.28SCF46751ViewN/A
4Cranberry-CNJ02-1-2017LG05N/A46.4SCF46751ViewN/A
5Cranberry-Mullica_Queen-2007LG5N/A68.2SCF46751ViewN/A
6Cranberry-Crimson_Queen-2007LG5N/A51.3SCF46751ViewN/A
7Blueberry-F1#10-2017LG05N/A49.9SCF46751ViewN/A
8Blueberry-W85-23-2017LG05.1N/A16.2SCF46751ViewN/A
9Cranberry-Mullica_Queen-2017LG05N/A50.4SCF46751ViewN/A
10Cranberry-CNJ02-1-2007LG5N/A58.74SCF46751ViewN/A
11Cranberry-Composite_map-F1LG05N/A51.89SCF46751ViewN/A
12Cranberry-Crimson_Queen-F1LG05N/A45.78SCF46751ViewN/A
13Cranberry-GH1/35-F1LG05N/A54.66SCF46751ViewN/A
14Cranberry-Mullica_Queen_1-F1LG05N/A60.85SCF46751ViewN/A
15Cranberry-BB/CQ-F1LG10N/A60.36SCF46751ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278715
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF46751.forward primerVaccinium macrocarponprimer
reverse primerSCF46751.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF46751SCF46751Vaccinium macrocarponmarker_locus
SCF46751SCF46751-51.89Vaccinium macrocarponmarker_locus
SCF46751SCF46751-45.78Vaccinium macrocarponmarker_locus
SCF46751SCF46751-54.66Vaccinium macrocarponmarker_locus
SCF46751SCF46751-60.85Vaccinium macrocarponmarker_locus
SCF46751SCF46751-60.36Vaccinium macrocarponmarker_locus
SCF46751SCF46751-17.275Vaccinium macrocarponmarker_locus