SCF46824, SCF46824 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF46824
Genbank IDKP278717
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(ATT)10
Primer 1SCF46824.forward primer: GGAGATGCTGTAATAACGAAGT
Primer 2SCF46824.reverse primer: TTAGTCAATATGCGTGCAAC
Max Length209
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG07N/A4.4SCF46824View
2Cranberry-Mullica_Queen-2017LG07N/A5SCF46824View
3Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG7N/A111.25SCF46824View
4Cranberry-Mullica_Queen-2007LG7N/A8.1SCF46824View
5Cranberry-CNJ02-1-2007LG7N/A7.63SCF46824View
6Cranberry-[BG//BL/BN]95-F1LG07N/A100.7SCF46824View
7Cranberry-Composite_map-F1LG07N/A89.89SCF46824View
8Cranberry-GH1/35-F1LG07N/A85.4SCF46824View
9Cranberry-Mullica_Queen_1-F1LG07N/A101.08SCF46824View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278717
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF46824.forward primerVaccinium macrocarponprimer
reverse primerSCF46824.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF46824SCF46824Vaccinium macrocarponmarker_locus
SCF46824SCF46824-100.7Vaccinium macrocarponmarker_locus
SCF46824SCF46824-89.89Vaccinium macrocarponmarker_locus
SCF46824SCF46824-85.4Vaccinium macrocarponmarker_locus
SCF46824SCF46824-101.08Vaccinium macrocarponmarker_locus