SCF54555, SCF54555 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF54555
Genbank ID	KP279025
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)10
Primer 1	SCF54555.forward primer: TTACCAAAGCACCCATTAAC
Primer 2	SCF54555.reverse primer: ACGACACATATCTCCAAAGTG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279025

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Composite_map-F1	LG06	N/A	83.12	SCF54555	View
2	Cranberry-Stevens-F1	LG06	N/A	73.26	SCF54555	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr6	supercontig	chr6:4307975..4308104 .