SCF55511, SCF55511 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF55511
Genbank ID	KP278729
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)9
Primer 1	SCF55511.forward primer: GAAGTGAAAATCTGAACCTCTC
Primer 2	SCF55511.reverse primer: ACTCTCGAATCTGTCTTCTTGT
Max Length	183
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278729

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10_x_W85-23-F1-2017	LG12	N/A	43.7	SCF55511	View
2	Blueberry-F1#10-2017	LG12	N/A	45.3	SCF55511	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold00233	supercontig	scaffold00233:140235..140400 .
Vmac_chr05	supercontig	Vmac_chr05:31716135..31716292 .
chr5	supercontig	chr5:3292425..3292582 .
Chr09	supercontig	Chr09:4787574..4787740 .