SCF55619, SCF55619 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF55619
Genbank ID	KP279026
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)9
Primer 1	SCF55619.forward primer: CAAAGAATCAGCAGGAGGT
Primer 2	SCF55619.reverse primer: GATGTCTAAGGTACAAGGAAGC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279026

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr12_H1	supercontig	chr12_H1:2213870..2214044 .
Vmac_chr07	supercontig	Vmac_chr07:1746253..1746423 .
chr7	supercontig	chr7:1410824..1410990 .