SCF58861, SCF58861 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF58861
Genbank IDKP278738
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TA)10
Primer 1SCF58861.forward primer: GTTGACTAAAAGGCATTGGA
Primer 2SCF58861.reverse primer: GACTACTATTTTCTGCACAGGG
Max Length164
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10_x_W85-23-F1-2017LG03N/A0.8SCF58861View
2Cranberry-CNJ02-1-2017LG03N/A0SCF58861View
3Blueberry-W85-23-2017LG03N/A0SCF58861View
4Blueberry-F1#10-2017LG03N/A0SCF58861View
5Cranberry-BB/CQ-F1LG07N/A0SCF58861View
6Cranberry-CNJ02-1-2007LG3N/A0.45SCF58861View
7Cranberry-Crimson_Queen-2017LG03N/A0SCF58861View
8Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG3N/A0SCF58861View
9Cranberry-Crimson_Queen-2007LG3N/A0SCF58861View
10Cranberry-Mullica_Queen-2017LG03N/A0SCF58861View
11Cranberry-Mullica_Queen-2007LG3N/A0.9SCF58861View
12Cranberry-Composite_map-F1LG03N/A88.74SCF58861View
13Cranberry-Crimson_Queen-F1LG03N/A87.84SCF58861View
14Cranberry-GH1/35-F1LG03N/A86.39SCF58861View
15Cranberry-Mullica_Queen_1-F1LG03N/A111.78SCF58861View
16Cranberry-BB/CQ-F1LG07N/A1.14SCF58861View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278738
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF58861.forward primerVaccinium macrocarponprimer
reverse primerSCF58861.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF58861SCF58861Vaccinium macrocarponmarker_locus
SCF58861SCF58861-88.74Vaccinium macrocarponmarker_locus
SCF58861SCF58861-87.84Vaccinium macrocarponmarker_locus
SCF58861SCF58861-86.39Vaccinium macrocarponmarker_locus
SCF58861SCF58861-111.78Vaccinium macrocarponmarker_locus
SCF58861SCF58861-1.135Vaccinium macrocarponmarker_locus