scf6341b, scf6341b (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf6341b
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf6341b.forward primer: AAACCCAGAAATGTTGGCTG
Primer 2	scf6341b.reverse primer: TGGTGGTGTGTGTCTGTGTG
Publication	[view all]

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG11b	N/A	6.3	scf6341b	View
2	Cranberry-BB/CQ-F1	LG11	N/A	52.13	scf6341b	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr11	supercontig	Vmac_chr11:14110919..14111063 .
chr11	supercontig	chr11:12815712..12815854 .