SCF77645, SCF77645 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF77645
Genbank ID	KP278765
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)10
Primer 1	SCF77645.forward primer: GGTTCTTTCTTCTGGGTTTT
Primer 2	SCF77645.reverse primer: TCAGACAATGAGCTACTACCCT
Max Length	343
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278765

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr08	supercontig	Vmac_chr08:13272374..13272644 .
chr8	supercontig	chr8:12931971..12932241 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Composite_map-F1	LG08	N/A	36.23	SCF77645	View
2	Cranberry-Crimson_Queen-F1	LG08	N/A	18.45	SCF77645	View
3	Cranberry-Mullica_Queen_1-F1	LG08	N/A	57.1	SCF77645	View
4	Blueberry-F1#10_x_W85-23-F1-2017	LG08	N/A	55.4	SCF77645	View
5	Blueberry-F1#10-2017	LG08	N/A	55.1	SCF77645	View
6	Blueberry-W85-23-2017	LG08	N/A	62.3	SCF77645	View
7	Cranberry-CNJ02-1-2017	LG08	N/A	52.3	SCF77645	View
8	Cranberry-Crimson_Queen-2017	LG08	N/A	50.1	SCF77645	View
9	Cranberry-Mullica_Queen-2017	LG08	N/A	51.9	SCF77645	View