scf72c, scf72c (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf72c
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf72c.forward primer: GAAGGAAGTGGCAATGATGG
Primer 2	scf72c.reverse primer: ACAGACAACGAATGCACAGC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr01	supercontig	Vmac_chr01:39385937..39386191 .
chr1	supercontig	chr1:10935519..10935777 .
Chr02_Vaccinium_vitis-idaea_ssp_minus	chromosome	Chr02_Vaccinium_vitis-idaea_ssp_minus:41196650..41196912 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG9	N/A	13.8	scf72c	View