SCF85773, SCF85773 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF85773
Genbank IDKP278780
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)12
Primer 1SCF85773.forward primer: TCTTGAACACAGCACAACAT
Primer 2SCF85773.reverse primer: ATAAGTTTGCCCCTTTTGTC
Max Length301
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG3N/A37.7SCF85773ViewN/A
2Cranberry-Crimson_Queen-2017LG03N/A26.2SCF85773ViewN/A
3Cranberry-Mullica_Queen-2017LG03N/A31.9SCF85773ViewN/A
4Cranberry-CNJ02-1-2007LG3N/A34.09SCF85773ViewN/A
5Cranberry-Crimson_Queen-2007LG3N/A29.7SCF85773ViewN/A
6Cranberry-Mullica_Queen-2007LG3N/A39.5SCF85773ViewN/A
7Cranberry-CNJ02-1-2017LG03N/A28.9SCF85773ViewN/A
8Cranberry-[BG//BL/BN]95-F1LG03N/A74.25SCF85773ViewN/A
9Cranberry-Composite_map-F1LG03N/A58.58SCF85773ViewN/A
10Cranberry-Crimson_Queen-F1LG03N/A56.84SCF85773ViewN/A
11Cranberry-Mullica_Queen_1-F1LG03N/A78.09SCF85773ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278780
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF85773.forward primerVaccinium macrocarponprimer
reverse primerSCF85773.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit color intensityqFCI.CNJ02-1.LG03.2Vaccinium macrocarponQTL
Fruit color variationqFCV.CNJ02-1.LG03.2Vaccinium macrocarponQTL
Proanthocyanidin contentqPAC.CNJ02-1.LG03.2Vaccinium macrocarponQTL
Total anthocyanin contentqTAC.CNJ02-1.LG03.2Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF85773SCF85773Vaccinium macrocarponmarker_locus
SCF85773SCF85773-74.25Vaccinium macrocarponmarker_locus
SCF85773SCF85773-58.58Vaccinium macrocarponmarker_locus
SCF85773SCF85773-56.84Vaccinium macrocarponmarker_locus
SCF85773SCF85773-78.09Vaccinium macrocarponmarker_locus