SCF74917, SCF74917 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF74917
Genbank ID	KP279034
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TA)11
Primer 1	SCF74917.forward primer: AAACATAAAGAGCAGCCAGTAG
Primer 2	SCF74917.reverse primer: CTGATAAATAGAGACAGACGGG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279034

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr03	supercontig	Vmac_chr03:25478713..25479018 .
chr3	supercontig	chr3:24846112..24846415 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.