SCF85946, SCF85946 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF85946
Genbank IDKP278781
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)10
Primer 1SCF85946.forward primer: TGTGAACAGAACCTACCACTAA
Primer 2SCF85946.reverse primer: AAAGAGCCCCGTAGATAGAT
Max Length328
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10-2017LG07N/A54.2SCF85946View
2Cranberry-Crimson_Queen-2017LG07N/A58.2SCF85946View
3Cranberry-CNJ02-1-2007LG7N/A65.1SCF85946View
4Blueberry-F1#10_x_W85-23-F1-2017LG07N/A53.5SCF85946View
5Cranberry-Crimson_Queen-2007LG7N/A59.7SCF85946View
6Cranberry-CNJ02-1-2017LG07N/A61.7SCF85946View
7Cranberry-Composite_map-F1LG07N/A29.45SCF85946View
8Cranberry-Crimson_Queen-F1LG07N/A30.4SCF85946View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278781
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF85946.forward primerVaccinium macrocarponprimer
reverse primerSCF85946.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF85946SCF85946Vaccinium macrocarponmarker_locus
SCF85946SCF85946-29.45Vaccinium macrocarponmarker_locus
SCF85946SCF85946-30.4Vaccinium macrocarponmarker_locus