scf9025, scf9025 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf9025
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf9025.forward primer: TGGCTCCTATAGCGTGTCCT
Primer 2scf9025.reverse primer: GCACACCAGGTTCCTTGATTTT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG03N/A55.3scf9025View
2Cranberry-Unifiedmap2013LG7aN/A55.1scf9025View
3Cranberry-Mullica_Queen-2017LG03N/A60.4scf9025View
4Cranberry-Crimson_Queen-2017LG03N/A50.3scf9025View
5Cranberry-Composite_map-F1LG03N/A36.53scf9025View
6Cranberry-Crimson_Queen-F1LG03N/A40.74scf9025View
7Cranberry-Mullica_Queen_1-F1LG03N/A47.14scf9025View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf9025.forward primerVaccinium macrocarponprimer
reverse primerscf9025.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
field fruit rot resistanceqFFRR.Unifiedmap2013.LG7Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf9025scf9025Vaccinium macrocarponmarker_locus
scf9025scf9025-36.53Vaccinium macrocarponmarker_locus
scf9025scf9025-40.74Vaccinium macrocarponmarker_locus
scf9025scf9025-47.14Vaccinium macrocarponmarker_locus