SCF89801, SCF89801 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF89801
Genbank IDKP278790
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)14
Primer 1SCF89801.forward primer: TAAACCTGTTCCGTCTCTTAGT
Primer 2SCF89801.reverse primer: CTTTACTGTTGTGTTGTCTGCT
Max Length338
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG06N/A17.7SCF89801View
2Cranberry-Mullica_Queen-2007LG6N/A31.2SCF89801View
3Cranberry-CNJ02-1-2007LG6N/A22.03SCF89801View
4Cranberry-Mullica_Queen-2017LG06N/A23.3SCF89801View
5Cranberry-Composite_map-F1LG06N/A69.16SCF89801View
6Cranberry-Mullica_Queen_1-F1LG06N/A79.97SCF89801View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278790
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF89801.forward primerVaccinium macrocarponprimer
reverse primerSCF89801.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF89801SCF89801Vaccinium macrocarponmarker_locus
SCF89801SCF89801-69.16Vaccinium macrocarponmarker_locus
SCF89801SCF89801-79.97Vaccinium macrocarponmarker_locus