SCF95767, SCF95767 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF95767
Genbank IDKP278796
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TA)9
Primer 1SCF95767.forward primer: TGAGGAGAGGAGTATCCATAAG
Primer 2SCF95767.reverse primer: CCTACAAGTCTCGCAATTCTA
Max Length302
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278796
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG11N/A0.86SCF95767View
2Cranberry-Crimson_Queen-2007LG11N/A1.2SCF95767View
3Cranberry-Mullica_Queen-2007LG11N/A0.4SCF95767View
4Cranberry-Crimson_Queen-F1LG11N/A0SCF95767View
5Cranberry-CNJ02-1-2017LG11N/A1.2SCF95767View
6Cranberry-Crimson_Queen-2017LG11N/A0SCF95767View
7Cranberry-Mullica_Queen-2017LG11N/A0SCF95767View
8Cranberry-Composite_map-F1LG11N/A1.19SCF95767View
9Cranberry-Mullica_Queen_1-F1LG11N/A0.6SCF95767View