vm48827, vm48827 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	vm48827
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AGT)6
Primer 1	vm48827.forward primer: CTTAGCACACTTGATGGAGTC
Primer 2	vm48827.reverse primer: GGAACGGGCTATAAGAATGTA
Product Length	247
Max Length	254
Publication	[view all]

Publications


Year	Publication
2012	Zhu H, Senalik D, McCown BH, Zeldin EL, Speers J, Hyman J, Bassil N, Hummer K, Simon PW, Zalapa JE. Mining and validation of pyrosequenced simple sequence repeats (SSRs) from American cranberry (Vaccinium macrocarpon Ait.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2012 Jan; 124(1):87-96.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff1	supercontig	VaccDscaff1:14789928..14790147 .
scaffold00663	supercontig	scaffold00663:123371..123589 .
chr1_H1	supercontig	chr1_H1:16158041..16158254 .
Vmac_chr06	supercontig	Vmac_chr06:11889219..11889439 .
chr6	supercontig	chr6:27399589..27399809 .
Chr01_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr01_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:32618532..32618784 .