vm79687, vm79687 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	vm79687
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)9
Primer 1	vm79687.forward primer: TTACTGTCATCCCTAGTTCAGC
Primer 2	vm79687.reverse primer: ACTAACCCATGGTGTAATGAAG
Product Length	270
Max Length	272
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vmac_chr03	supercontig	Vmac_chr03:14534809..14535047 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr3	supercontig	chr3:13734455..13734693 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Zhu H, Senalik D, McCown BH, Zeldin EL, Speers J, Hyman J, Bassil N, Hummer K, Simon PW, Zalapa JE. Mining and validation of pyrosequenced simple sequence repeats (SSRs) from American cranberry (Vaccinium macrocarpon Ait.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2012 Jan; 124(1):87-96.