KAN254, KAN254 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN254
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN254.Forward Primer: CCACTTCTAAGGCGAATGGA
Primer 2	KAN254.Reverse Primer: CAGAATTTCCCCCACGAATA
Publication	[view all]

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-Draper	LG4	N/A	0	KAN-254	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr07	supercontig	Vcev1_p0.Chr07:46536629..46536832 .