KAN286, KAN286 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN286
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN286.Forward Primer: GGACGGTTGAGATACGTGCT
Primer 2	KAN286.Reverse Primer: CAGTGAGAGAAAAGCGAGGC
Publication	[view all]

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-Draper	LG4	N/A	117	KAN-286	View
2	Blueberry-Jewel	LG4a	N/A	30	KAN-286	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff46	supercontig	VaccDscaff46:895212..895461 .
Vmac_chr07	supercontig	Vmac_chr07:13143451..13143686 .