|
|
Marker Overview
| Name | Pr032475742 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Vaccinium corymbosum |
|---|
| Primer 1 | Pr032475742.Forward Primer: CACACTCCCACAGTCTCAAA |
|---|
| Primer 2 | Pr032475742.Reverse Primer: CCAGAGACCCAAATTAGCAA |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 2016 | McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24. |
Alignments
The following features are aligned
|
