Pr032605974, Pr032605974 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr032605974
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr032605974.Forward Primer: AACTTCACCCCTCACTCATCAC
Primer 2	Pr032605974.Reverse Primer: CTGGCTTTATTGACGGCTTATC
Publication	[view all]

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-Draper	LG10	N/A	141	Pr032605974	View
2	Blueberry-Jewel	LG10a	N/A	103	Pr032605974	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff153	supercontig	VaccDscaff153:149709..149915 .
Vmac_chr02	supercontig	Vmac_chr02:1769515..1769741 .
chr2	supercontig	chr2:1586053..1586281 .
Chr11	supercontig	Chr11:34252365..34252625 .
Chr11_Vaccinium_vitis-idaea_ssp_minus	chromosome	Chr11_Vaccinium_vitis-idaea_ssp_minus:40331069..40331271 .