VCBC02051, VCBC02051 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	VCBC02051
Genbank ID	N/A
Type	EST-SSR
Species	Vaccinium corymbosum
Repeat Motif	(tc)5
Primer 1	VCBC02051.forward primer: GGAAGTCCTTTTCCAGCTCTCT
Primer 2	VCBC02051.reverse primer: ATCGGAAGGAAAGGAAAGAGTC
Product Length	119
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vcev1_p0.Chr04	supercontig	Vcev1_p0.Chr04:38207216..38207315 .	Vaccinium caesariense clone W85-20 P0 v2.0 genome sequence	GDV marker alignment to genome using primer sequences
scaffold00861	supercontig	scaffold00861:111407..111506 .	Vaccinium corymbosum W8520 draft genome sequence	GDV marker alignment to genome using primer sequences
chr4_H1	supercontig	chr4_H1:30372327..30372426 .	Vaccinium darrowii clone NJ8810/NJ8807 v1.2 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Rowland LJ, Alkharouf N, Darwish O, Ogden EL, Polashock JJ, Bassil NV, Main D. Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation. BMC plant biology. 2012; 12:46.