|
|
Marker Overview
| Name | CA1105 |
|---|
| Genbank ID | CV090268 |
|---|
| Type | EST marker |
|---|
| Species | Vaccinium corymbosum |
|---|
| Primer 1 | CA1105.forward primer: TGGTGCTTTCATCCTGCTAA |
|---|
| Primer 2 | CA1105.reverse primer: GCTTGCTTCTTGGGTGACTC |
|---|
| Product Length | 714 |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | CV090268 |
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2008 | Bell DJ, Rowland LJ, Polashock JJ, Drummond FA. Suitability of EST-PCR Markers Developed in Highbush Blueberry for Genetic Fingerprinting and Relationship Studies in Lowbush Blueberry and Related Species. Journal of the American Society for Horticultural Science. 2008; 133(5):701-707. |
| 2014 | Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048. |
|
