|
|
Marker Overview
| Name | CA1785S |
|---|
| Genbank ID | CV090750 |
|---|
| Type | EST marker |
|---|
| Species | Vaccinium corymbosum |
|---|
| Primer 1 | CA1785S.forward primer: AATCCAGCACCTGTGATTCCCAA |
|---|
| Primer 2 | CA1785S.reverse primer: TTCCGGTCAGGTCTTGT |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | CV090750 |
Publications
| Year | Publication |
|---|
| 2009 | Bell DJ, Rowland LJ, Zhang D, Drummond FA. Spatial genetic structure of lowbush blueberry, Vaccinium angustifolium, in four fields in Maine. Botany. 2009; 87(10):932-946. |
| 2014 | Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048. |
|
