|
Marker Overview
Name | CA1785S |
Genbank ID | CV090750 |
Type | EST marker |
Species | Vaccinium corymbosum |
Primer 1 | CA1785S.forward primer: AATCCAGCACCTGTGATTCCCAA |
Primer 2 | CA1785S.reverse primer: TTCCGGTCAGGTCTTGT |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | CV090750 |
Publications
Year | Publication |
2009 | Bell DJ, Rowland LJ, Zhang D, Drummond FA. Spatial genetic structure of lowbush blueberry, Vaccinium angustifolium, in four fields in Maine. Botany. 2009; 87(10):932-946. |
2014 | Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048. |
|