KAN11348, KAN11348 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN11348
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN11348.forward primer: TATCTCCGATCTGTTTCCCG
Primer 2	KAN11348.reverse primer: GCCCTGATCTGAAAGTCACC
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vcev1_p0.Chr07	supercontig	Vcev1_p0.Chr07:480744..480986 .	Vaccinium caesariense clone W85-20 P0 v2.0 genome sequence	GDV marker alignment to genome using primer sequences
Chr07	supercontig	Chr07:35201113..35201358 .	Vaccinium myrtillus isolate NK2018 v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG2	N/A	10	KAN-11348_260	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG10	N/A	0	KAN-11348	View
3	Blueberry-F1#10-2017	LG10	N/A	0	KAN-11348	View