KAN11529, KAN11529 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN11529
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Repeat Motif	(AT)6
Primer 1	KAN11529.forward primer: CCCTGGTTCTTGTGGTTCTT
Primer 2	KAN11529.reverse primer: GGGCGGCTCGAATATGTTA
Max Length	282
Publication	[view all]

Publications


Year	Publication
2014	Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location	Analysis
Vcev1_p0.Chr04	supercontig	Vcev1_p0.Chr04:8025890..8026124 .	Vaccinium caesariense clone W85-20 P0 v2.0 genome sequence
scaffold01436	supercontig	scaffold01436:9165..9389 .	Vaccinium corymbosum W8520 draft genome sequence