KAN28196, KAN28196 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN28196
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Repeat Motif	(AATA)5
Primer 1	KAN28196.forward primer: AAAAACAAGTGGTTTCAAATATGC
Primer 2	KAN28196.reverse primer: GTTAACGGAGCACGTGAATG
Max Length	276
Publication	[view all]

Publications


Year	Publication
2014	Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold00108	supercontig	scaffold00108:225779..226038 .
Chr12_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr12_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:35324168..35324426 .