KAN41257, KAN41257 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN41257
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Repeat Motif	(AGA)6
Primer 1	KAN41257.forward primer: AAACCCTGGTGCTGAAATTG
Primer 2	KAN41257.reverse primer: GTGGCCATGAGGTTTGTCTT
Max Length	251
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vcev1_p0.Chr09	supercontig	Vcev1_p0.Chr09:46423859..46424094 .	Vaccinium caesariense clone W85-20 P0 v2.0 genome sequence	GDV marker alignment to genome using primer sequences
scaffold00163	supercontig	scaffold00163:164824..165059 .	Vaccinium corymbosum W8520 draft genome sequence	GDV marker alignment to genome using primer sequences
chr9_H1	supercontig	chr9_H1:37756191..37756423 .	Vaccinium darrowii clone NJ8810/NJ8807 v1.2 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689.