ripe-01939, ripe-01939 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	ripe-01939
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	ripe-01939.forward primer: TGGTGCTTCTTTCCTTGACC
Primer 2	ripe-01939.reverse primer: TACCTTTTGCATCCCACCAC
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vmac_chr11	supercontig	Vmac_chr11:16813440..16814105 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr11	supercontig	chr11:15402777..15403566 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG3	N/A	54	ripe-01939	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG11	N/A	46.6	ripe-01939	View
3	Blueberry-F1#10-2017	LG11	N/A	47.2	ripe-01939	View