Pr031818813, Pr031818813 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr031818813
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr031818813.forward primer: CCGATCCAAATCCATGTCTA
Primer 2	Pr031818813.reverse primer: CCCATCAGTCCTTCACTTCA
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	144	Pr031818813	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG02.1	N/A	8.2	Pr031818813	View
3	Blueberry-F1#10-2017	LG02.1	N/A	4.8	Pr031818813	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.C061	supercontig	Vcev1_p0.C061:6385..6587 .
VaccDscaff347	supercontig	VaccDscaff347:72994..73198 .