Pr031818813, Pr031818813 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr031818813
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr031818813.forward primer: CCGATCCAAATCCATGTCTA
Primer 2	Pr031818813.reverse primer: CCCATCAGTCCTTCACTTCA
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vcev1_p0.C061	supercontig	Vcev1_p0.C061:6385..6587 .	Vaccinium caesariense clone W85-20 P0 v2.0 genome sequence	GDV marker alignment to genome using primer sequences
VaccDscaff347	supercontig	VaccDscaff347:72994..73198 .	Vaccinium corymbosum cv. Draper v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	144	Pr031818813	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG02.1	N/A	8.2	Pr031818813	View
3	Blueberry-F1#10-2017	LG02.1	N/A	4.8	Pr031818813	View