VCBC11525, VCBC11525 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	VCBC11525
Genbank ID	N/A
Type	EST-SSR
Species	Vaccinium corymbosum
Repeat Motif	(ac)5
Primer 1	VCBC11525.forward primer: AACTGAAGAACAAACCATTGCC
Primer 2	VCBC11525.reverse primer: GCAACTATTTGTGTGGGTTGAA
Product Length	117
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr12_H1	supercontig	chr12_H1:40196899..40196998 .	Vaccinium darrowii clone NJ8810/NJ8807 v1.2 genome sequence	GDV marker alignment to genome using primer sequences
Vmac_chr07	supercontig	Vmac_chr07:35773470..35773569 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr7	supercontig	chr7:34768986..34769085 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences
Chr12	supercontig	Chr12:34418888..34418987 .	Vaccinium myrtillus isolate NK2018 v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Rowland LJ, Alkharouf N, Darwish O, Ogden EL, Polashock JJ, Bassil NV, Main D. Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation. BMC plant biology. 2012; 12:46.