VCC_J1, VCC_J1 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameVCC_J1
Genbank IDAY762680
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(CA)6
Primer 1VCC_J1.forward primer: CTCATGGGTTCCCATAGACAA
Primer 2VCC_J1.reverse primer: TGCAGTGAGGCAAAAGATTG
Max Length225
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG11bN/A0VCC_J1ViewN/A
2Cranberry-Unifiedmap2013LG12N/A9.4VCC_J1ViewN/A
3Cranberry-Unifiedmap2013LG1N/A1.4VCC_J1ViewN/A
4blueberry-DraperLG11N/A31VCC-J1bViewN/A
5blueberry-DraperLG4N/A94VCC_J1cViewN/A
6blueberry-JewelLG11aN/A23VCC_J1aViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAY762680
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerVCC_J1.forward primerVaccinium corymbosumprimer
reverse primerVCC_J1.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
VCC_J1VCC_J1Vaccinium corymbosummarker_locus
VCC-J1bVCC-J1bVaccinium corymbosummarker_locus
VCC_J1cVCC_J1cVaccinium corymbosummarker_locus
VCC_J1aVCC_J1aVaccinium corymbosummarker_locus