|
Marker Overview
Name | VCC_J1 |
Genbank ID | AY762680 |
Type | SSR |
Species | Vaccinium corymbosum |
Repeat Motif | (CA)6 |
Primer 1 | VCC_J1.forward primer: CTCATGGGTTCCCATAGACAA |
Primer 2 | VCC_J1.reverse primer: TGCAGTGAGGCAAAAGATTG |
Max Length | 225 |
Publication | [view all] |
Publications
Year | Publication |
2006 | Boches P, Bassil N, Rowland L. Genetic Diversity in the Highbush Blueberry Evaluated with Microsatellite Markers. Journal of the American Society for Horticultural Science. 2006; 131(5):674-686. |
2005 | Boches P, Bassil N, Rowland L. Microsatellite markers for Vaccinium from EST and genomic libraries. Molecular ecology notes. 2005; 5(3):657-660. |
2016 | McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24. |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | AY762680 |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
|