vco01-6ms4, vco01-6ms4 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	vco01-6ms4
Genbank ID	N/A
Type	EST-SSR
Species	Vaccinium corymbosum
Repeat Motif	(AG)5/(GAA)4
Primer 1	vco01-6ms4.forward primer: CACGGCAGAGCAGAGTAGAA
Primer 2	vco01-6ms4.reverse primer: GCTTTGTGCAACGTCTTTGA
Max Length	167
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vcev1_p0.Chr07	supercontig	Vcev1_p0.Chr07:28524918..28525068 .	Vaccinium caesariense clone W85-20 P0 v2.0 genome sequence	GDV marker alignment to genome using primer sequences
VaccDscaff12	supercontig	VaccDscaff12:25939464..25939616 .	Vaccinium corymbosum cv. Draper v1.0 genome sequence	GDV marker alignment to genome using primer sequences
scaffold03179	supercontig	scaffold03179:11388..11538 .	Vaccinium corymbosum W8520 draft genome sequence	GDV marker alignment to genome using primer sequences
chr7_H1	supercontig	chr7_H1:22736956..22737108 .	Vaccinium darrowii clone NJ8810/NJ8807 v1.2 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689.
2005	Boches P, Bassil N, Rowland L. Microsatellite markers for Vaccinium from EST and genomic libraries. Molecular ecology notes. 2005; 5(3):657-660.