ct117109, ct117109 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	ct117109
Genbank ID	KP279151
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)9
Primer 1	ct117109.forward primer: TTGacGTCTTCTCTCTCTTTCT
Primer 2	ct117109.reverse primer: CTAGGGTTCATACTTCGAAAAG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279151

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff11	supercontig	VaccDscaff11:18306269..18306519 .