NA619, NA619 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameNA619
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1NA619.forward primer: TCACACTACAGGCAGGAGAGA
Primer 2NA619.reverse primer: GAAGCCCCAGTTCTCACAAG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG09N/A36.5NA619ViewN/A
2Cranberry-Crimson_Queen-2017LG09N/A30.1NA619ViewN/A
3Cranberry-Unifiedmap2013LG1N/A68.3NA619ViewN/A
4Cranberry-Mullica_Queen-2007LG9N/A44.7NA619ViewN/A
5Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG9N/A46.04NA619ViewN/A
6Cranberry-CNJ02-1-2007LG9N/A38.35NA619ViewN/A
7Cranberry-Mullica_Queen-2017LG09N/A43.6NA619ViewN/A
8Cranberry-Crimson_Queen-2007LG9N/A37.4NA619ViewN/A
9Cranberry-Composite_map-F1LG09N/A59.09NA619ViewN/A
10Cranberry-Crimson_Queen-F1LG09N/A41.17NA619ViewN/A
11Cranberry-Mullica_Queen_1-F1LG09N/A65.59NA619ViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNA619.forward primerVaccinium corymbosumprimer
reverse primerNA619.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NA619NA619Vaccinium corymbosummarker_locus
NA619NA619-59.09Vaccinium corymbosummarker_locus
NA619NA619-41.17Vaccinium corymbosummarker_locus
NA619NA619-65.59Vaccinium corymbosummarker_locus