SCF124927, SCF124927 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF124927
Genbank IDKP278850
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TG)12
Primer 1SCF124927.forward primer: CGAGTGTCATTAGCAACAGA
Primer 2SCF124927.reverse primer: TATCACTTTAGATCGAGCAGAC
Max Length236
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG6N/A82.6SCF124927View
2Cranberry-Crimson_Queen-2017LG06N/A69.9SCF124927View
3Cranberry-CNJ02-1-2017LG06N/A83.5SCF124927View
4Cranberry-CNJ02-1-2007LG6N/A96.87SCF124927View
5Blueberry-W85-23-2017LG06N/A107.8SCF124927View
6Blueberry-F1#10-2017LG06N/A91SCF124927View
7Cranberry-Mullica_Queen-2007LG6N/A113SCF124927View
8Cranberry-Mullica_Queen-2017LG06N/A96.5SCF124927View
9Blueberry-F1#10_x_W85-23-F1-2017LG06N/A81.2SCF124927View
10Cranberry-Composite_map-F1LG06N/A3.02SCF124927View
11Cranberry-Crimson_Queen-F1LG06N/A1.19SCF124927View
12Cranberry-Mullica_Queen_1-F1LG06N/A2.38SCF124927View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278850
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF124927.forward primerVaccinium macrocarponprimer
reverse primerSCF124927.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF124927SCF124927Vaccinium macrocarponmarker_locus
SCF124927SCF124927-3.02Vaccinium macrocarponmarker_locus
SCF124927SCF124927-1.19Vaccinium macrocarponmarker_locus
SCF124927SCF124927-2.38Vaccinium macrocarponmarker_locus