SCF122746, SCF122746 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF122746
Genbank IDKP278846
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)13
Primer 1SCF122746.forward primer: ATTGTATGAAAACCCTAACCC
Primer 2SCF122746.reverse primer: GAGACGATTCCAAATATAGCA
Max Length218
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG11N/A10.4SCF122746View
2Cranberry-CNJ02-1-2017LG11N/A14SCF122746View
3Cranberry-Mullica_Queen-2017LG11N/A16.1SCF122746View
4Cranberry-Crimson_Queen-2017LG11N/A9.2SCF122746View
5Cranberry-Mullica_Queen-2007LG11N/A14.8SCF122746View
6Cranberry-CNJ02-1-2007LG11N/A12.75SCF122746View
7Cranberry-Composite_map-F1LG11N/A11.07SCF122746View
8Cranberry-Crimson_Queen-F1LG11N/A8.35SCF122746View
9Cranberry-Mullica_Queen_1-F1LG11N/A16.7SCF122746View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278846
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF122746.forward primerVaccinium macrocarponprimer
reverse primerSCF122746.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit weightqFWT.CNJ02-1.LG11.1Vaccinium macrocarponQTL
fruit weightqFWT.CNJ02-1.LG11.2012Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF122746SCF122746Vaccinium macrocarponmarker_locus
SCF122746SCF122746-11.07Vaccinium macrocarponmarker_locus
SCF122746SCF122746-8.35Vaccinium macrocarponmarker_locus
SCF122746SCF122746-16.7Vaccinium macrocarponmarker_locus