SCF157301, SCF157301 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF157301
Genbank ID	KP279091
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AG)10
Primer 1	SCF157301.forward primer: CGTTACATACTCCACCCAAT
Primer 2	SCF157301.reverse primer: GATTTCAAGAAGGGTTTGTG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279091

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Chr07_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr07_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:4553875..4554111 .