scf34s, scf34s (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf34s
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(ct)20
Primer 1scf34s.forward primer: TACCCGGCCGTATATGTAGC
Primer 2scf34s.reverse primer: AATGTGACGTCAGAGGGAGG
Max Length202
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG1N/A8.6scf34sViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf34s.forward primerVaccinium macrocarponprimer
reverse primerscf34s.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf34sscf34sVaccinium macrocarponmarker_locus